klc95973 klc95973
  • 01-07-2020
  • Mathematics
contestada

what is the midpoint of the line segment with endpoints (3.2,2.5) and (1.6,-4.5)?

Respuesta :

Space
Space Space
  • 01-07-2020

Answer:

Midpoint: (2.4, -1)

Step-by-step explanation:

Midpoint Formula: [tex](\frac{x1+x2}{2} , \frac{y1+y2}{2} )[/tex]

With that in mind,

(3.2 + 1.6)/2 = 2.4

(2.5 - 4.5)/2 = -1

Answer Link
wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 01-07-2020

Answer:

(2.4, -1)

Step-by-step explanation:

To find the x coordinate of the midpoint, average the x coordinates

(3.2+1.6)/2 = 4.8/2 = 2.4

To find the y coordinate of the midpoint, average the y coordinates

(2.5+-4.5)/2 = -2/2 = -1

(2.4, -1)

Answer Link

Otras preguntas

What is being optimistic​
what is an element?​
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
If the farmer has 164 feet of fencing, what is the largest area the farmer can enclose?
HELP PLEASE PLEASE geographical information can appear in books calledA. Calendars B. SonneteersC. journals D. gazetteers​
whats the equation 2+2 yo
Eight more than the number n is equal to 25. find the number n
Do this for me please - correct answer gets brainliest!
Can someone please write an explanatory essay of the chrysanthemums.
can an element be broken down