Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Read the excerpt from Thoughts and Sentiments. And if such men can boast of greater degrees of knowledge, than any African is entitled to, I shall let them enjo

One market sells a 3 kilogram bag of tortillas for 42 pesos and another sells 2 kilograms of tortillas for 26 pesos which unit price is lower

The process that first detects an external stimulus is _____.

plz answer this asap first answer gets brainliest and 100 points

Eli bought 2/5 of a crate of fruit and Jared bought 1/10 less of the crate than eli. How much of the crate did they buy altogether?

The figures below are based on semicircles and squares. Find the perimeter and the area of each shape. Give your answer as a completely simplified exact value i

PLEASE HELP ME!!! 20 POINTS! PLEASE complete the following two-way table of row relative frequencies! Thank you!

How do the reproductive habits of koalas affect their genetic diversity? **please let me know very soon**

How do u reduce stress In your life

A circle has an area of 616 square meters. Which measurement is closest to the radius of the circle, in meters?