liz02bal liz02bal

01-04-2020
Physics

contestada

Oxidation and reduction are processes which

Respuesta :

max2788 max2788

01-04-2020

Answer:

Oxidation is increase in oxidation number while reduction is decrease in oxidation number.Redox is change in oxidation number.

Answer Link

Otras preguntas

I know you would not mind if we could fight and wrest the scepter from your hands. you know that we are powerless to do that, for you have ensured our incapacit

Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.

What does the word "Islam" mean?

Use the excerpt to answer the question. We hold these truths to be self-evident: that all men and women are created equal; that they are endowed by their Creato

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A child finds 30 nickels and dimes between sofa cushions. how many dimes did the child find if the total value of the coins is $1.90?

if the accuracy in measuring the position of a particle increases, what happens to the accuracy in measuring its velocity?

Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi

How did the Hellenistic kings spread Greek culture

from what you have heard about modern war