karlaz899 karlaz899
  • 15-11-2019
  • Mathematics
contestada

A light bulb consumes 3300 watt-hours in 5 days and 12 hours. How many watt-hours does it consume per day?

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 25-05-2022

Answer:

  600 W·h/day

Step-by-step explanation:

To find the energy consumption per day, divide the energy consumption by the corresponding number of days.

__

  (3300 W·h)/(5.5 days) = 600 W·h/day

Answer Link

Otras preguntas

the reproductive system of a male mammal provides
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Give a recursive algorithm for finding the sum of the first n odd positive integers.
What statement best describes a republic?
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate