proftwinki proftwinki

13-06-2019
Mathematics

contestada

using the formula: w=xyz, find w when x=22, y=12. z=6

Respuesta :

Аноним Аноним

13-06-2019

Answer:

40

Step-by-step explanation:

If w = xyz then it will be:

22 + 12 + 6 = 40

Answer Link

Otras preguntas

I accidentally clicked one, can you please tell me if it's correct or not. if you don't know, please don't answer I need a 100 on this.Thank you :)

Which are physical changes? Chopping a piece of wood. Fireworks(the explosion) Evaporation of water. Rusting of a nail.

Which of the following i an example of an intres group A) the United Nations B) people for ethical treatment of animals C) the Democratic Party D) the senate

If the refractive index of a medium is 1.3,then what will be the speed of light in the medium ?don't spamexplanation is needed

ANSWER FAST AND GET ALOT OF POINTS The histograms and summary statistics summarize the data for the number of hits in the season by baseball players in two leag

Writing: how do Atalantas conflicts remind you of real life ASAP IT ALMOST DUE

Find the GCF of the terms of each polynomial.72y5 + 18y2

Your team is discussing the material options before approving the construction contract. What actions can you take to demonstrate respect? Select all that apply

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Which angles are corresponding angles? Check all that apply. 1. 3 4 5 6 8