aaron10neymar aaron10neymar
  • 13-11-2018
  • Mathematics
contestada

The nile river, the longest river in the world, is 66.7x100 kilometers long. What is the nile's length?

Respuesta :

matthewlovesports
matthewlovesports matthewlovesports
  • 13-11-2018

Well if you multiply 66.7 x 100 you get 6,670.0. When multiplying by numbers like 10, 100, 1,000, etc, just simply transfer the 0's. So in this case, there are 2 0's in 100, so you add 2 of the 0's behind 66.7.  So when you add the 2 of the 0's you get 6,670.0 which should be your answer.

Answer Link

Otras preguntas

Please someone help me with this. ​
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
Write the quadratic equation that has roots √3 +1/2 and √3 −1/2 , if its coefficient with x^2 is equal to 9
Is economic inequality a problem in the United States? Is it a problem globally? Why or why not?
The propotion, 6/8 x x/36 can be solved using the Cross Product Property. Which equation correctly represents the Cross Product Property?
Vicky has worked for the same company since January 2011. Her starting salary was $52,000 and she has received a $1,000 raise on the first day of each year. 1.
A prospector graphed the locations of a gold vein and all of the gold dust strikes in the vicinity. He positioned the gold vein at ( − 8 , 9 ) ( - 8 , 9 ) and t
State the transformations performed on the parent function f(x)
seven more than three times a number is 25 what is the number? please help asap thank u so much
What’s x?? Solve for x 5x+2=7x-4