marrissam5158 marrissam5158

15-10-2018
Mathematics

contestada

184 jumping jacks in 4 mins how many can he do in one minute

Respuesta :

bellaoroz bellaoroz

15-10-2018

46 jumping jacks, you divide 184 by 4 and get the answer of 46

Answer Link

Otras preguntas

Who did Adam Smith think should be in charge of the economy? * * The Workers The Business Owners

ㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤ

please someone help me!!!!!!!!!!

the spanish class system placed people in the top class primarily based on?

According to the map, who controlled part of the Pacific coast after 1763?

What is a protest play?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Triangle LMN similar to triangle OPQ find the measure of side PQ round your answer to the nearest 10th if necessary

please someone help me!!!!!!!!!!

Which mood does foreshadowing help create in “The Monkey's Paw”? one of anxiety one of hospitality one of revenge one of serenity