Mordens21 Mordens21

04-10-2018
Mathematics

contestada

-(1-5x)=8x+25 please help

Respuesta :

meredith48034 meredith48034

04-10-2018

-1 + 5x = 8x + 25

-1 - 3x = 25

-3x = 26

x = -26/3

Answer Link

Otras preguntas

How do you determine the type of ion charge any element will form based on its number of valence electrons?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the area of this composed figure

Many assume that presidents with high __________ are more effective leaders.

Access to valuable ______ may be playing a role in papua new guinea's struggle against islands that want to secede from that nation.

what is r in this equation? πr^2=42π

what are the zeros of the polynomial x2+4x-12

A person is selected at random from a crowd. You want to find the probability of the event that this person is a female and the probability of the event that th

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1

Differences between body composition- risk for heart disease or chronic disease.