collinzjordan7144 collinzjordan7144

13-05-2018
History

contestada

"ask not what your country can do for you; ask what you can do for your country" is an example of metaphor.

Respuesta :

zeldarila zeldarila

13-05-2018

i think its a metaphor for leadership

Answer Link

Otras preguntas

A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa

Social disparity was one of the major causes of french revolution. Justify the statement

Can things of aluminum have a greater mass than things made of iron?

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

100 points to whoever answers this question!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height (in meters) f

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

__________ is a good example of congressional casework. analysis of an incumbent's policy positions prior to a debate analysis of water quality within a distric

Find the missing value. sin x = .65

Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors