aidenlumpkins219 aidenlumpkins219
  • 13-11-2022
  • Biology
contestada

Using the following genomic sequence:


1) Underline each Intron


2) Circle each exon


GUUAUGAGUCGUUGGCAUUAAUCUUUCCUUAUGAUUGUCGCUGAUCGUUAG

UCGUCCAUGCGUGGUGGCUGACUUCCAAUGACCAAAUCUUCGGUGGCGGAG

UAACAUAUAAGAAUGACCAAAAGGCGUCGAUGAGGAUGUGGCAAUUAACAUC

Respuesta :

Otras preguntas

9-10 = 6(r +1) Write a formula for h(r) in terms of r​
Groups of three or more bonded atoms are called
La universidad es muy grande, hay (1) estudiantes en el campus. Hay personas de (2) países diferentes y (3) son estudiantes de España. La biblioteca tiene (4) l
A ski shop skis with lengths ranging from 150 centimeters to 220 centimeters. The shops says the length of the skis should be about 1.16 times a skin's height.W
unabbreviated electron configuration of magnesium
HELP! simplify (4^7/5^2)^3.
Corey found a mineral that is gray, shiny, and splits into sheets. What kind of mineral did he find?
(15 POINTS AND BRAINLIEST) How did the Cultural Revolution of 1966 impact China? A.Many protests took place and the government became more democratic in respons
how do you solve 27?
What album was released three years after the death of the artist that’s tattooed on the upper left arm of the actor who played irish micky ward in a 2010 film?