damianprieto3456 damianprieto3456

13-10-2022
Mathematics

contestada

Express your answer in scientific notation.

5.4x10^5 + 6.7x10^4

Respuesta :

Otras preguntas

2. Technology required. ABCD is a rectangle. Find the length of AC and the measures of a and e. Help pleaseee

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Book or Tatum? Will mark brainliest!

I REALLY NEED HELP PLEASE

Which of these expressions below is less than 345? Select all that apply.A) 342.35 + 4.19 B) 256.79 + 98.11 C) 356.09 -10.45D) 419.56 - 75.68 E) 199.75 +143.712

2/3x times 3 answer quickly pleasseeee

"Just one hour, una hora, is all I'm asking of you, son." My grandfather is in a nursing home in Brooklyn, and my mother wants me to spend some time with him, s

I WILL GIVE BRAINLIEST!!! Sculpting Bright Minds Schools and educators have recognized the value of including the fine arts in the school curriculum. However,

certain plant grows 1 3 4 inches every week. How long will it take the plant to grow 6 1 4 inches? How long will it take the plant to grow 6 1 4 inches?

the spanish class system placed people in the top class primarily based on?