JessiJess4134 JessiJess4134

12-09-2022
Mathematics

contestada

What is the sum of the zeros of the polynomial function y= x² -4 y-5 ?

Respuesta :

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

a what model might include a drawing or a three-dimensional object.

What is the expression in factored form? -9.4 (15) + (12.3) (-9.4) Enter your answer by filling in the boxes.

-3(745) What is the value of + 9(2) -6 -2 o14 o22 Pls answer

Ai là người khởi nghĩa hai bà trưng

In physics, _____ is defined as a change in position over time. a momentum b vector C motion d distance

Read the passage. Long ago in the Imperial Court, the emperor fell in love with a certain lady. She was not of a high rank, nor was she of a low rank. The emper

A contractor purchases 5 dozen pairs of padded work gloves for $69.60. He incorrectly calculates the unit price as$13.92 per pair for the expense report. What i

Experts claim that this number of repetitions helps to internalize a word:

12+[2-(4•5^2)] ÷ 7 + 1